Review



multis one step cloning kit  (Vazyme Biotech Co)


Bioz Verified Symbol Vazyme Biotech Co is a verified supplier
Bioz Manufacturer Symbol Vazyme Biotech Co manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97

    Structured Review

    Vazyme Biotech Co multis one step cloning kit
    Multis One Step Cloning Kit, supplied by Vazyme Biotech Co, used in various techniques. Bioz Stars score: 97/100, based on 1454 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/c113/ClonExpress+MultiS+One+Step+Cloning+Kit/pmc12995870-48-40-45
    Average 97 stars, based on 1454 article reviews
    multis one step cloning kit - by Bioz Stars, 2026-09
    97/100 stars

    Images

    Related Articles

    other:

    Article Title: A stable and antibiotic-free plasmid expression system for Salmonella typhimurium VNP20009 in tumor therapy
    Article Snippet: ClonExpress MultiS One Step Cloning Kit , Vazyme , Cat# C113.

    Cloning:

    Article Title: A novel NF2 splicing mutant causes neurofibromatosis type 2 via liquid-liquid phase separation with large tumor suppressor and Hippo pathway
    Article Snippet: Subcellular Protein Fractionation Kit , Thermo Scientific , Cat# 78840. .. ClonExpress ® MultiS One Step Cloning Kit , Vazyme , Cat# C113. .. SuperReal PreMix Plus (SYBR Green) , TIANGEN , Cat# FP205.

    Article Title: DMAP1 Deficiency Suppresses Lung Cancer Progression by Destabilizing Replication Fork and Activating IFN Signaling-Mediated Anti-tumor Immunity.
    Article Snippet: .. All overexpression plasmids of DMAP1 were contructed into pCDH- CMV-MCS-EF1-neo or pCDH- CMV-MCSA-EF1-neo/puro using ClonExpress MultiS One Step Cloning it (Vazyme, C113). .. The plasmid pLV3-ISRE-minP-Fluc-T2AGFP was purchased from MIAOLING PLASMID, and the mIfn βmouseminimumpromoter and the neomycin eukaryotic 4 of 20 resistance were cloned into it using Vazyme C113.

    Article Title: Protocol for studying in vitro mouse primary thymocyte differentiation via retroviral-mediated gene expression and stromal-free stimulation
    Article Snippet: MojoSort Streptavidin Nanobeads , BioLegend , Cat# 480016. .. cloneExpress MultiS One Step Cloning Kit , Vazyme , Cat# C113. .. TIANprep Midi Plasmid Kit , TianGen , Cat# DP106-02.

    Article Title: Identification and analysis of short open reading frame-encoded peptides in different regions of mouse brain
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains E. coli DH5α WEIDI Cat# DL1001 Chemicals, peptides, and recombinant proteins IP_873491: VPVGAVIR GenScript N/A IP_853008: LPLLAGVR GenScript N/A IP_1063868: LYVLRIR GenScript N/A IP_1092194: SAIMNLR GenScript N/A IP_1030074: IVNINSK GenScript N/A IP_3454466: LSLHERR GenScript N/A IP_2555767: LLEAKIR GenScript N/A IP_896167: IVADLLR Bankpeptide N/A IP_3469861: ASLSSLSR GenScript N/A Dulbecco’s Modified Eagle Medium (DMEM) Gibco Cat# C11995500BT Opti-MEM reduced serum medium Gibco Cat# 31985-062 Fetal bovine serum (FBS) Vivacell Cat# C04001-500 Trypsin Promega Cat# 0000541741 Iodoacetamide (IAM) Sigma Cat# I1149 Dithiothreitol (DTT) Solarbio Cat# D8220 Critical commercial assays ClonExpress MultiS One Step Cloning Kit Vazyme Cat# C113-02 FastKing RT Kit (With gDNase) TIANGEN Cat# KR116 EndoFree Mini Plasmid Kit TIANGEN Cat# DP118 TlANgel Midi Purification Kit TIANGEN Cat# DP209 Ultrapure RNA Kit CWBIO Cat# CW0581 LipofectamineTM 3000 Transfection Reagent Thermofisher Cat# L3000001 Deposited data Raw proteomics data This paper ProteomeXchange: PXD036064 Experimental models: Cell lines Mouse: Neuro-2a cell Procell Life Science&Technology Company https://www.procell.com.cn Experimental models: Organisms/strains Mouse: C57BL6/J Hubei Provincial Center for Disease Control and Prevention https://www.hbcdc.com/ Mouse: BALB/c Hubei Provincial Center for Disease Control and Prevention https://www.hbcdc.com/ Oligonucleotides IP_2419830_F: ATGGAGACAGTCACAAGACGCTCG This paper N/A IP_2419830_R: GCCTCGCCGCATGGCAATAGCCGTAG This paper N/A IP_1018875_F: ATGAAGTGGATGTTTAAGGAGGACCACTC This paper N/A IP_1018875_R: TCCACATGAA CTAAGAAGCC ACGGTGATG This paper N/A IP_2419830_GFP_F: CTATAGGGAGACCCAAGCTG GCTAGCATGGAGACAGTCACAAGACGCT This paper N/A IP_2419830_GFP_R: GGTGGATCCG AGTCGGTAC C AAGCTTGCCT CGCCGCATGG CAATAG This paper N/A IP_1018875_GFP_F: CTATAGGGAGACCCAA GCTGGCTAGCATGAAGTGGATGTTTAAGGAG This paper N/A IP_1018875_GFP_R: GGTGGATCCG AGTCGGT ACC AAGCTTTCCA CATGAACTAA GAAGC This paper N/A Recombinant DNA Plasmid: pcDNA 3.1_GFP This paper N/A Plasmid: pcDNA 3.1_IP_2419830_GFP This paper N/A Plasmid: pcDNA 3.1_IP_1018875_GFP This paper N/A Software and algorithms Metascape http://metascape.org/gp/index.html#/main/step1 N/A TBtools TBtools software N/A GraphPad Prism 8.3.1 https://www.graphpad.com/ N/A Pepquery http://pepquery.org N/A MEGA11 https://www.megasoftware.net/ N/A Proteome Discover 2.1 Thermofisher N/A Open in a separate window Key resources table . ..

    Article Title: Survival and attachment of Listeria monocytogenes on bell peppers and influence of attachment time on efficacy of chlorine
    Article Snippet: ll OPEN ACCESS iScience

    Article Title: Metabolic Engineering of Escherichia coli for the Production of Cadaverine from Lignocellulose.
    Article Snippet: Efficient production of biobased monomers from lignocellulosic hydrolysates is considered an important approach to reducing product costs and achieving sustainable biomanufacturing.. However, the low conversion efficiency leads to a low yield and extended fermentation cycles.. Here, we enhanced the utilization efficiency of xylose by strengthening the isomerase pathway.

    Over Expression:

    Article Title: DMAP1 Deficiency Suppresses Lung Cancer Progression by Destabilizing Replication Fork and Activating IFN Signaling-Mediated Anti-tumor Immunity.
    Article Snippet: .. All overexpression plasmids of DMAP1 were contructed into pCDH- CMV-MCS-EF1-neo or pCDH- CMV-MCSA-EF1-neo/puro using ClonExpress MultiS One Step Cloning it (Vazyme, C113). .. The plasmid pLV3-ISRE-minP-Fluc-T2AGFP was purchased from MIAOLING PLASMID, and the mIfn βmouseminimumpromoter and the neomycin eukaryotic 4 of 20 resistance were cloned into it using Vazyme C113.

    Virus:

    Article Title: Identification and analysis of short open reading frame-encoded peptides in different regions of mouse brain
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains E. coli DH5α WEIDI Cat# DL1001 Chemicals, peptides, and recombinant proteins IP_873491: VPVGAVIR GenScript N/A IP_853008: LPLLAGVR GenScript N/A IP_1063868: LYVLRIR GenScript N/A IP_1092194: SAIMNLR GenScript N/A IP_1030074: IVNINSK GenScript N/A IP_3454466: LSLHERR GenScript N/A IP_2555767: LLEAKIR GenScript N/A IP_896167: IVADLLR Bankpeptide N/A IP_3469861: ASLSSLSR GenScript N/A Dulbecco’s Modified Eagle Medium (DMEM) Gibco Cat# C11995500BT Opti-MEM reduced serum medium Gibco Cat# 31985-062 Fetal bovine serum (FBS) Vivacell Cat# C04001-500 Trypsin Promega Cat# 0000541741 Iodoacetamide (IAM) Sigma Cat# I1149 Dithiothreitol (DTT) Solarbio Cat# D8220 Critical commercial assays ClonExpress MultiS One Step Cloning Kit Vazyme Cat# C113-02 FastKing RT Kit (With gDNase) TIANGEN Cat# KR116 EndoFree Mini Plasmid Kit TIANGEN Cat# DP118 TlANgel Midi Purification Kit TIANGEN Cat# DP209 Ultrapure RNA Kit CWBIO Cat# CW0581 LipofectamineTM 3000 Transfection Reagent Thermofisher Cat# L3000001 Deposited data Raw proteomics data This paper ProteomeXchange: PXD036064 Experimental models: Cell lines Mouse: Neuro-2a cell Procell Life Science&Technology Company https://www.procell.com.cn Experimental models: Organisms/strains Mouse: C57BL6/J Hubei Provincial Center for Disease Control and Prevention https://www.hbcdc.com/ Mouse: BALB/c Hubei Provincial Center for Disease Control and Prevention https://www.hbcdc.com/ Oligonucleotides IP_2419830_F: ATGGAGACAGTCACAAGACGCTCG This paper N/A IP_2419830_R: GCCTCGCCGCATGGCAATAGCCGTAG This paper N/A IP_1018875_F: ATGAAGTGGATGTTTAAGGAGGACCACTC This paper N/A IP_1018875_R: TCCACATGAA CTAAGAAGCC ACGGTGATG This paper N/A IP_2419830_GFP_F: CTATAGGGAGACCCAAGCTG GCTAGCATGGAGACAGTCACAAGACGCT This paper N/A IP_2419830_GFP_R: GGTGGATCCG AGTCGGTAC C AAGCTTGCCT CGCCGCATGG CAATAG This paper N/A IP_1018875_GFP_F: CTATAGGGAGACCCAA GCTGGCTAGCATGAAGTGGATGTTTAAGGAG This paper N/A IP_1018875_GFP_R: GGTGGATCCG AGTCGGT ACC AAGCTTTCCA CATGAACTAA GAAGC This paper N/A Recombinant DNA Plasmid: pcDNA 3.1_GFP This paper N/A Plasmid: pcDNA 3.1_IP_2419830_GFP This paper N/A Plasmid: pcDNA 3.1_IP_1018875_GFP This paper N/A Software and algorithms Metascape http://metascape.org/gp/index.html#/main/step1 N/A TBtools TBtools software N/A GraphPad Prism 8.3.1 https://www.graphpad.com/ N/A Pepquery http://pepquery.org N/A MEGA11 https://www.megasoftware.net/ N/A Proteome Discover 2.1 Thermofisher N/A Open in a separate window Key resources table . ..

    Recombinant:

    Article Title: Identification and analysis of short open reading frame-encoded peptides in different regions of mouse brain
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains E. coli DH5α WEIDI Cat# DL1001 Chemicals, peptides, and recombinant proteins IP_873491: VPVGAVIR GenScript N/A IP_853008: LPLLAGVR GenScript N/A IP_1063868: LYVLRIR GenScript N/A IP_1092194: SAIMNLR GenScript N/A IP_1030074: IVNINSK GenScript N/A IP_3454466: LSLHERR GenScript N/A IP_2555767: LLEAKIR GenScript N/A IP_896167: IVADLLR Bankpeptide N/A IP_3469861: ASLSSLSR GenScript N/A Dulbecco’s Modified Eagle Medium (DMEM) Gibco Cat# C11995500BT Opti-MEM reduced serum medium Gibco Cat# 31985-062 Fetal bovine serum (FBS) Vivacell Cat# C04001-500 Trypsin Promega Cat# 0000541741 Iodoacetamide (IAM) Sigma Cat# I1149 Dithiothreitol (DTT) Solarbio Cat# D8220 Critical commercial assays ClonExpress MultiS One Step Cloning Kit Vazyme Cat# C113-02 FastKing RT Kit (With gDNase) TIANGEN Cat# KR116 EndoFree Mini Plasmid Kit TIANGEN Cat# DP118 TlANgel Midi Purification Kit TIANGEN Cat# DP209 Ultrapure RNA Kit CWBIO Cat# CW0581 LipofectamineTM 3000 Transfection Reagent Thermofisher Cat# L3000001 Deposited data Raw proteomics data This paper ProteomeXchange: PXD036064 Experimental models: Cell lines Mouse: Neuro-2a cell Procell Life Science&Technology Company https://www.procell.com.cn Experimental models: Organisms/strains Mouse: C57BL6/J Hubei Provincial Center for Disease Control and Prevention https://www.hbcdc.com/ Mouse: BALB/c Hubei Provincial Center for Disease Control and Prevention https://www.hbcdc.com/ Oligonucleotides IP_2419830_F: ATGGAGACAGTCACAAGACGCTCG This paper N/A IP_2419830_R: GCCTCGCCGCATGGCAATAGCCGTAG This paper N/A IP_1018875_F: ATGAAGTGGATGTTTAAGGAGGACCACTC This paper N/A IP_1018875_R: TCCACATGAA CTAAGAAGCC ACGGTGATG This paper N/A IP_2419830_GFP_F: CTATAGGGAGACCCAAGCTG GCTAGCATGGAGACAGTCACAAGACGCT This paper N/A IP_2419830_GFP_R: GGTGGATCCG AGTCGGTAC C AAGCTTGCCT CGCCGCATGG CAATAG This paper N/A IP_1018875_GFP_F: CTATAGGGAGACCCAA GCTGGCTAGCATGAAGTGGATGTTTAAGGAG This paper N/A IP_1018875_GFP_R: GGTGGATCCG AGTCGGT ACC AAGCTTTCCA CATGAACTAA GAAGC This paper N/A Recombinant DNA Plasmid: pcDNA 3.1_GFP This paper N/A Plasmid: pcDNA 3.1_IP_2419830_GFP This paper N/A Plasmid: pcDNA 3.1_IP_1018875_GFP This paper N/A Software and algorithms Metascape http://metascape.org/gp/index.html#/main/step1 N/A TBtools TBtools software N/A GraphPad Prism 8.3.1 https://www.graphpad.com/ N/A Pepquery http://pepquery.org N/A MEGA11 https://www.megasoftware.net/ N/A Proteome Discover 2.1 Thermofisher N/A Open in a separate window Key resources table . ..

    Modification:

    Article Title: Identification and analysis of short open reading frame-encoded peptides in different regions of mouse brain
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains E. coli DH5α WEIDI Cat# DL1001 Chemicals, peptides, and recombinant proteins IP_873491: VPVGAVIR GenScript N/A IP_853008: LPLLAGVR GenScript N/A IP_1063868: LYVLRIR GenScript N/A IP_1092194: SAIMNLR GenScript N/A IP_1030074: IVNINSK GenScript N/A IP_3454466: LSLHERR GenScript N/A IP_2555767: LLEAKIR GenScript N/A IP_896167: IVADLLR Bankpeptide N/A IP_3469861: ASLSSLSR GenScript N/A Dulbecco’s Modified Eagle Medium (DMEM) Gibco Cat# C11995500BT Opti-MEM reduced serum medium Gibco Cat# 31985-062 Fetal bovine serum (FBS) Vivacell Cat# C04001-500 Trypsin Promega Cat# 0000541741 Iodoacetamide (IAM) Sigma Cat# I1149 Dithiothreitol (DTT) Solarbio Cat# D8220 Critical commercial assays ClonExpress MultiS One Step Cloning Kit Vazyme Cat# C113-02 FastKing RT Kit (With gDNase) TIANGEN Cat# KR116 EndoFree Mini Plasmid Kit TIANGEN Cat# DP118 TlANgel Midi Purification Kit TIANGEN Cat# DP209 Ultrapure RNA Kit CWBIO Cat# CW0581 LipofectamineTM 3000 Transfection Reagent Thermofisher Cat# L3000001 Deposited data Raw proteomics data This paper ProteomeXchange: PXD036064 Experimental models: Cell lines Mouse: Neuro-2a cell Procell Life Science&Technology Company https://www.procell.com.cn Experimental models: Organisms/strains Mouse: C57BL6/J Hubei Provincial Center for Disease Control and Prevention https://www.hbcdc.com/ Mouse: BALB/c Hubei Provincial Center for Disease Control and Prevention https://www.hbcdc.com/ Oligonucleotides IP_2419830_F: ATGGAGACAGTCACAAGACGCTCG This paper N/A IP_2419830_R: GCCTCGCCGCATGGCAATAGCCGTAG This paper N/A IP_1018875_F: ATGAAGTGGATGTTTAAGGAGGACCACTC This paper N/A IP_1018875_R: TCCACATGAA CTAAGAAGCC ACGGTGATG This paper N/A IP_2419830_GFP_F: CTATAGGGAGACCCAAGCTG GCTAGCATGGAGACAGTCACAAGACGCT This paper N/A IP_2419830_GFP_R: GGTGGATCCG AGTCGGTAC C AAGCTTGCCT CGCCGCATGG CAATAG This paper N/A IP_1018875_GFP_F: CTATAGGGAGACCCAA GCTGGCTAGCATGAAGTGGATGTTTAAGGAG This paper N/A IP_1018875_GFP_R: GGTGGATCCG AGTCGGT ACC AAGCTTTCCA CATGAACTAA GAAGC This paper N/A Recombinant DNA Plasmid: pcDNA 3.1_GFP This paper N/A Plasmid: pcDNA 3.1_IP_2419830_GFP This paper N/A Plasmid: pcDNA 3.1_IP_1018875_GFP This paper N/A Software and algorithms Metascape http://metascape.org/gp/index.html#/main/step1 N/A TBtools TBtools software N/A GraphPad Prism 8.3.1 https://www.graphpad.com/ N/A Pepquery http://pepquery.org N/A MEGA11 https://www.megasoftware.net/ N/A Proteome Discover 2.1 Thermofisher N/A Open in a separate window Key resources table . ..

    Article Title: Survival and attachment of Listeria monocytogenes on bell peppers and influence of attachment time on efficacy of chlorine
    Article Snippet: ll OPEN ACCESS iScience

    Plasmid Preparation:

    Article Title: Identification and analysis of short open reading frame-encoded peptides in different regions of mouse brain
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains E. coli DH5α WEIDI Cat# DL1001 Chemicals, peptides, and recombinant proteins IP_873491: VPVGAVIR GenScript N/A IP_853008: LPLLAGVR GenScript N/A IP_1063868: LYVLRIR GenScript N/A IP_1092194: SAIMNLR GenScript N/A IP_1030074: IVNINSK GenScript N/A IP_3454466: LSLHERR GenScript N/A IP_2555767: LLEAKIR GenScript N/A IP_896167: IVADLLR Bankpeptide N/A IP_3469861: ASLSSLSR GenScript N/A Dulbecco’s Modified Eagle Medium (DMEM) Gibco Cat# C11995500BT Opti-MEM reduced serum medium Gibco Cat# 31985-062 Fetal bovine serum (FBS) Vivacell Cat# C04001-500 Trypsin Promega Cat# 0000541741 Iodoacetamide (IAM) Sigma Cat# I1149 Dithiothreitol (DTT) Solarbio Cat# D8220 Critical commercial assays ClonExpress MultiS One Step Cloning Kit Vazyme Cat# C113-02 FastKing RT Kit (With gDNase) TIANGEN Cat# KR116 EndoFree Mini Plasmid Kit TIANGEN Cat# DP118 TlANgel Midi Purification Kit TIANGEN Cat# DP209 Ultrapure RNA Kit CWBIO Cat# CW0581 LipofectamineTM 3000 Transfection Reagent Thermofisher Cat# L3000001 Deposited data Raw proteomics data This paper ProteomeXchange: PXD036064 Experimental models: Cell lines Mouse: Neuro-2a cell Procell Life Science&Technology Company https://www.procell.com.cn Experimental models: Organisms/strains Mouse: C57BL6/J Hubei Provincial Center for Disease Control and Prevention https://www.hbcdc.com/ Mouse: BALB/c Hubei Provincial Center for Disease Control and Prevention https://www.hbcdc.com/ Oligonucleotides IP_2419830_F: ATGGAGACAGTCACAAGACGCTCG This paper N/A IP_2419830_R: GCCTCGCCGCATGGCAATAGCCGTAG This paper N/A IP_1018875_F: ATGAAGTGGATGTTTAAGGAGGACCACTC This paper N/A IP_1018875_R: TCCACATGAA CTAAGAAGCC ACGGTGATG This paper N/A IP_2419830_GFP_F: CTATAGGGAGACCCAAGCTG GCTAGCATGGAGACAGTCACAAGACGCT This paper N/A IP_2419830_GFP_R: GGTGGATCCG AGTCGGTAC C AAGCTTGCCT CGCCGCATGG CAATAG This paper N/A IP_1018875_GFP_F: CTATAGGGAGACCCAA GCTGGCTAGCATGAAGTGGATGTTTAAGGAG This paper N/A IP_1018875_GFP_R: GGTGGATCCG AGTCGGT ACC AAGCTTTCCA CATGAACTAA GAAGC This paper N/A Recombinant DNA Plasmid: pcDNA 3.1_GFP This paper N/A Plasmid: pcDNA 3.1_IP_2419830_GFP This paper N/A Plasmid: pcDNA 3.1_IP_1018875_GFP This paper N/A Software and algorithms Metascape http://metascape.org/gp/index.html#/main/step1 N/A TBtools TBtools software N/A GraphPad Prism 8.3.1 https://www.graphpad.com/ N/A Pepquery http://pepquery.org N/A MEGA11 https://www.megasoftware.net/ N/A Proteome Discover 2.1 Thermofisher N/A Open in a separate window Key resources table . ..

    Article Title: Survival and attachment of Listeria monocytogenes on bell peppers and influence of attachment time on efficacy of chlorine
    Article Snippet: ll OPEN ACCESS iScience

    Article Title: Metabolic Engineering of Escherichia coli for the Production of Cadaverine from Lignocellulose.
    Article Snippet: Efficient production of biobased monomers from lignocellulosic hydrolysates is considered an important approach to reducing product costs and achieving sustainable biomanufacturing.. However, the low conversion efficiency leads to a low yield and extended fermentation cycles.. Here, we enhanced the utilization efficiency of xylose by strengthening the isomerase pathway.

    Purification:

    Article Title: Identification and analysis of short open reading frame-encoded peptides in different regions of mouse brain
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains E. coli DH5α WEIDI Cat# DL1001 Chemicals, peptides, and recombinant proteins IP_873491: VPVGAVIR GenScript N/A IP_853008: LPLLAGVR GenScript N/A IP_1063868: LYVLRIR GenScript N/A IP_1092194: SAIMNLR GenScript N/A IP_1030074: IVNINSK GenScript N/A IP_3454466: LSLHERR GenScript N/A IP_2555767: LLEAKIR GenScript N/A IP_896167: IVADLLR Bankpeptide N/A IP_3469861: ASLSSLSR GenScript N/A Dulbecco’s Modified Eagle Medium (DMEM) Gibco Cat# C11995500BT Opti-MEM reduced serum medium Gibco Cat# 31985-062 Fetal bovine serum (FBS) Vivacell Cat# C04001-500 Trypsin Promega Cat# 0000541741 Iodoacetamide (IAM) Sigma Cat# I1149 Dithiothreitol (DTT) Solarbio Cat# D8220 Critical commercial assays ClonExpress MultiS One Step Cloning Kit Vazyme Cat# C113-02 FastKing RT Kit (With gDNase) TIANGEN Cat# KR116 EndoFree Mini Plasmid Kit TIANGEN Cat# DP118 TlANgel Midi Purification Kit TIANGEN Cat# DP209 Ultrapure RNA Kit CWBIO Cat# CW0581 LipofectamineTM 3000 Transfection Reagent Thermofisher Cat# L3000001 Deposited data Raw proteomics data This paper ProteomeXchange: PXD036064 Experimental models: Cell lines Mouse: Neuro-2a cell Procell Life Science&Technology Company https://www.procell.com.cn Experimental models: Organisms/strains Mouse: C57BL6/J Hubei Provincial Center for Disease Control and Prevention https://www.hbcdc.com/ Mouse: BALB/c Hubei Provincial Center for Disease Control and Prevention https://www.hbcdc.com/ Oligonucleotides IP_2419830_F: ATGGAGACAGTCACAAGACGCTCG This paper N/A IP_2419830_R: GCCTCGCCGCATGGCAATAGCCGTAG This paper N/A IP_1018875_F: ATGAAGTGGATGTTTAAGGAGGACCACTC This paper N/A IP_1018875_R: TCCACATGAA CTAAGAAGCC ACGGTGATG This paper N/A IP_2419830_GFP_F: CTATAGGGAGACCCAAGCTG GCTAGCATGGAGACAGTCACAAGACGCT This paper N/A IP_2419830_GFP_R: GGTGGATCCG AGTCGGTAC C AAGCTTGCCT CGCCGCATGG CAATAG This paper N/A IP_1018875_GFP_F: CTATAGGGAGACCCAA GCTGGCTAGCATGAAGTGGATGTTTAAGGAG This paper N/A IP_1018875_GFP_R: GGTGGATCCG AGTCGGT ACC AAGCTTTCCA CATGAACTAA GAAGC This paper N/A Recombinant DNA Plasmid: pcDNA 3.1_GFP This paper N/A Plasmid: pcDNA 3.1_IP_2419830_GFP This paper N/A Plasmid: pcDNA 3.1_IP_1018875_GFP This paper N/A Software and algorithms Metascape http://metascape.org/gp/index.html#/main/step1 N/A TBtools TBtools software N/A GraphPad Prism 8.3.1 https://www.graphpad.com/ N/A Pepquery http://pepquery.org N/A MEGA11 https://www.megasoftware.net/ N/A Proteome Discover 2.1 Thermofisher N/A Open in a separate window Key resources table . ..

    Article Title: Survival and attachment of Listeria monocytogenes on bell peppers and influence of attachment time on efficacy of chlorine
    Article Snippet: ll OPEN ACCESS iScience

    Transfection:

    Article Title: Identification and analysis of short open reading frame-encoded peptides in different regions of mouse brain
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains E. coli DH5α WEIDI Cat# DL1001 Chemicals, peptides, and recombinant proteins IP_873491: VPVGAVIR GenScript N/A IP_853008: LPLLAGVR GenScript N/A IP_1063868: LYVLRIR GenScript N/A IP_1092194: SAIMNLR GenScript N/A IP_1030074: IVNINSK GenScript N/A IP_3454466: LSLHERR GenScript N/A IP_2555767: LLEAKIR GenScript N/A IP_896167: IVADLLR Bankpeptide N/A IP_3469861: ASLSSLSR GenScript N/A Dulbecco’s Modified Eagle Medium (DMEM) Gibco Cat# C11995500BT Opti-MEM reduced serum medium Gibco Cat# 31985-062 Fetal bovine serum (FBS) Vivacell Cat# C04001-500 Trypsin Promega Cat# 0000541741 Iodoacetamide (IAM) Sigma Cat# I1149 Dithiothreitol (DTT) Solarbio Cat# D8220 Critical commercial assays ClonExpress MultiS One Step Cloning Kit Vazyme Cat# C113-02 FastKing RT Kit (With gDNase) TIANGEN Cat# KR116 EndoFree Mini Plasmid Kit TIANGEN Cat# DP118 TlANgel Midi Purification Kit TIANGEN Cat# DP209 Ultrapure RNA Kit CWBIO Cat# CW0581 LipofectamineTM 3000 Transfection Reagent Thermofisher Cat# L3000001 Deposited data Raw proteomics data This paper ProteomeXchange: PXD036064 Experimental models: Cell lines Mouse: Neuro-2a cell Procell Life Science&Technology Company https://www.procell.com.cn Experimental models: Organisms/strains Mouse: C57BL6/J Hubei Provincial Center for Disease Control and Prevention https://www.hbcdc.com/ Mouse: BALB/c Hubei Provincial Center for Disease Control and Prevention https://www.hbcdc.com/ Oligonucleotides IP_2419830_F: ATGGAGACAGTCACAAGACGCTCG This paper N/A IP_2419830_R: GCCTCGCCGCATGGCAATAGCCGTAG This paper N/A IP_1018875_F: ATGAAGTGGATGTTTAAGGAGGACCACTC This paper N/A IP_1018875_R: TCCACATGAA CTAAGAAGCC ACGGTGATG This paper N/A IP_2419830_GFP_F: CTATAGGGAGACCCAAGCTG GCTAGCATGGAGACAGTCACAAGACGCT This paper N/A IP_2419830_GFP_R: GGTGGATCCG AGTCGGTAC C AAGCTTGCCT CGCCGCATGG CAATAG This paper N/A IP_1018875_GFP_F: CTATAGGGAGACCCAA GCTGGCTAGCATGAAGTGGATGTTTAAGGAG This paper N/A IP_1018875_GFP_R: GGTGGATCCG AGTCGGT ACC AAGCTTTCCA CATGAACTAA GAAGC This paper N/A Recombinant DNA Plasmid: pcDNA 3.1_GFP This paper N/A Plasmid: pcDNA 3.1_IP_2419830_GFP This paper N/A Plasmid: pcDNA 3.1_IP_1018875_GFP This paper N/A Software and algorithms Metascape http://metascape.org/gp/index.html#/main/step1 N/A TBtools TBtools software N/A GraphPad Prism 8.3.1 https://www.graphpad.com/ N/A Pepquery http://pepquery.org N/A MEGA11 https://www.megasoftware.net/ N/A Proteome Discover 2.1 Thermofisher N/A Open in a separate window Key resources table . ..

    Article Title: Survival and attachment of Listeria monocytogenes on bell peppers and influence of attachment time on efficacy of chlorine
    Article Snippet: ll OPEN ACCESS iScience

    Control:

    Article Title: Identification and analysis of short open reading frame-encoded peptides in different regions of mouse brain
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains E. coli DH5α WEIDI Cat# DL1001 Chemicals, peptides, and recombinant proteins IP_873491: VPVGAVIR GenScript N/A IP_853008: LPLLAGVR GenScript N/A IP_1063868: LYVLRIR GenScript N/A IP_1092194: SAIMNLR GenScript N/A IP_1030074: IVNINSK GenScript N/A IP_3454466: LSLHERR GenScript N/A IP_2555767: LLEAKIR GenScript N/A IP_896167: IVADLLR Bankpeptide N/A IP_3469861: ASLSSLSR GenScript N/A Dulbecco’s Modified Eagle Medium (DMEM) Gibco Cat# C11995500BT Opti-MEM reduced serum medium Gibco Cat# 31985-062 Fetal bovine serum (FBS) Vivacell Cat# C04001-500 Trypsin Promega Cat# 0000541741 Iodoacetamide (IAM) Sigma Cat# I1149 Dithiothreitol (DTT) Solarbio Cat# D8220 Critical commercial assays ClonExpress MultiS One Step Cloning Kit Vazyme Cat# C113-02 FastKing RT Kit (With gDNase) TIANGEN Cat# KR116 EndoFree Mini Plasmid Kit TIANGEN Cat# DP118 TlANgel Midi Purification Kit TIANGEN Cat# DP209 Ultrapure RNA Kit CWBIO Cat# CW0581 LipofectamineTM 3000 Transfection Reagent Thermofisher Cat# L3000001 Deposited data Raw proteomics data This paper ProteomeXchange: PXD036064 Experimental models: Cell lines Mouse: Neuro-2a cell Procell Life Science&Technology Company https://www.procell.com.cn Experimental models: Organisms/strains Mouse: C57BL6/J Hubei Provincial Center for Disease Control and Prevention https://www.hbcdc.com/ Mouse: BALB/c Hubei Provincial Center for Disease Control and Prevention https://www.hbcdc.com/ Oligonucleotides IP_2419830_F: ATGGAGACAGTCACAAGACGCTCG This paper N/A IP_2419830_R: GCCTCGCCGCATGGCAATAGCCGTAG This paper N/A IP_1018875_F: ATGAAGTGGATGTTTAAGGAGGACCACTC This paper N/A IP_1018875_R: TCCACATGAA CTAAGAAGCC ACGGTGATG This paper N/A IP_2419830_GFP_F: CTATAGGGAGACCCAAGCTG GCTAGCATGGAGACAGTCACAAGACGCT This paper N/A IP_2419830_GFP_R: GGTGGATCCG AGTCGGTAC C AAGCTTGCCT CGCCGCATGG CAATAG This paper N/A IP_1018875_GFP_F: CTATAGGGAGACCCAA GCTGGCTAGCATGAAGTGGATGTTTAAGGAG This paper N/A IP_1018875_GFP_R: GGTGGATCCG AGTCGGT ACC AAGCTTTCCA CATGAACTAA GAAGC This paper N/A Recombinant DNA Plasmid: pcDNA 3.1_GFP This paper N/A Plasmid: pcDNA 3.1_IP_2419830_GFP This paper N/A Plasmid: pcDNA 3.1_IP_1018875_GFP This paper N/A Software and algorithms Metascape http://metascape.org/gp/index.html#/main/step1 N/A TBtools TBtools software N/A GraphPad Prism 8.3.1 https://www.graphpad.com/ N/A Pepquery http://pepquery.org N/A MEGA11 https://www.megasoftware.net/ N/A Proteome Discover 2.1 Thermofisher N/A Open in a separate window Key resources table . ..

    Software:

    Article Title: Identification and analysis of short open reading frame-encoded peptides in different regions of mouse brain
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains E. coli DH5α WEIDI Cat# DL1001 Chemicals, peptides, and recombinant proteins IP_873491: VPVGAVIR GenScript N/A IP_853008: LPLLAGVR GenScript N/A IP_1063868: LYVLRIR GenScript N/A IP_1092194: SAIMNLR GenScript N/A IP_1030074: IVNINSK GenScript N/A IP_3454466: LSLHERR GenScript N/A IP_2555767: LLEAKIR GenScript N/A IP_896167: IVADLLR Bankpeptide N/A IP_3469861: ASLSSLSR GenScript N/A Dulbecco’s Modified Eagle Medium (DMEM) Gibco Cat# C11995500BT Opti-MEM reduced serum medium Gibco Cat# 31985-062 Fetal bovine serum (FBS) Vivacell Cat# C04001-500 Trypsin Promega Cat# 0000541741 Iodoacetamide (IAM) Sigma Cat# I1149 Dithiothreitol (DTT) Solarbio Cat# D8220 Critical commercial assays ClonExpress MultiS One Step Cloning Kit Vazyme Cat# C113-02 FastKing RT Kit (With gDNase) TIANGEN Cat# KR116 EndoFree Mini Plasmid Kit TIANGEN Cat# DP118 TlANgel Midi Purification Kit TIANGEN Cat# DP209 Ultrapure RNA Kit CWBIO Cat# CW0581 LipofectamineTM 3000 Transfection Reagent Thermofisher Cat# L3000001 Deposited data Raw proteomics data This paper ProteomeXchange: PXD036064 Experimental models: Cell lines Mouse: Neuro-2a cell Procell Life Science&Technology Company https://www.procell.com.cn Experimental models: Organisms/strains Mouse: C57BL6/J Hubei Provincial Center for Disease Control and Prevention https://www.hbcdc.com/ Mouse: BALB/c Hubei Provincial Center for Disease Control and Prevention https://www.hbcdc.com/ Oligonucleotides IP_2419830_F: ATGGAGACAGTCACAAGACGCTCG This paper N/A IP_2419830_R: GCCTCGCCGCATGGCAATAGCCGTAG This paper N/A IP_1018875_F: ATGAAGTGGATGTTTAAGGAGGACCACTC This paper N/A IP_1018875_R: TCCACATGAA CTAAGAAGCC ACGGTGATG This paper N/A IP_2419830_GFP_F: CTATAGGGAGACCCAAGCTG GCTAGCATGGAGACAGTCACAAGACGCT This paper N/A IP_2419830_GFP_R: GGTGGATCCG AGTCGGTAC C AAGCTTGCCT CGCCGCATGG CAATAG This paper N/A IP_1018875_GFP_F: CTATAGGGAGACCCAA GCTGGCTAGCATGAAGTGGATGTTTAAGGAG This paper N/A IP_1018875_GFP_R: GGTGGATCCG AGTCGGT ACC AAGCTTTCCA CATGAACTAA GAAGC This paper N/A Recombinant DNA Plasmid: pcDNA 3.1_GFP This paper N/A Plasmid: pcDNA 3.1_IP_2419830_GFP This paper N/A Plasmid: pcDNA 3.1_IP_1018875_GFP This paper N/A Software and algorithms Metascape http://metascape.org/gp/index.html#/main/step1 N/A TBtools TBtools software N/A GraphPad Prism 8.3.1 https://www.graphpad.com/ N/A Pepquery http://pepquery.org N/A MEGA11 https://www.megasoftware.net/ N/A Proteome Discover 2.1 Thermofisher N/A Open in a separate window Key resources table . ..

    Extraction:

    Article Title: Metabolic Engineering of Escherichia coli for the Production of Cadaverine from Lignocellulose.
    Article Snippet: Efficient production of biobased monomers from lignocellulosic hydrolysates is considered an important approach to reducing product costs and achieving sustainable biomanufacturing.. However, the low conversion efficiency leads to a low yield and extended fermentation cycles.. Here, we enhanced the utilization efficiency of xylose by strengthening the isomerase pathway.

    Isolation:

    Article Title: Metabolic Engineering of Escherichia coli for the Production of Cadaverine from Lignocellulose.
    Article Snippet: Efficient production of biobased monomers from lignocellulosic hydrolysates is considered an important approach to reducing product costs and achieving sustainable biomanufacturing.. However, the low conversion efficiency leads to a low yield and extended fermentation cycles.. Here, we enhanced the utilization efficiency of xylose by strengthening the isomerase pathway.

    Bacteria:

    Article Title: Metabolic Engineering of Escherichia coli for the Production of Cadaverine from Lignocellulose.
    Article Snippet: Efficient production of biobased monomers from lignocellulosic hydrolysates is considered an important approach to reducing product costs and achieving sustainable biomanufacturing.. However, the low conversion efficiency leads to a low yield and extended fermentation cycles.. Here, we enhanced the utilization efficiency of xylose by strengthening the isomerase pathway.

    Polymerase Chain Reaction:

    Article Title: Metabolic Engineering of Escherichia coli for the Production of Cadaverine from Lignocellulose.
    Article Snippet: Efficient production of biobased monomers from lignocellulosic hydrolysates is considered an important approach to reducing product costs and achieving sustainable biomanufacturing.. However, the low conversion efficiency leads to a low yield and extended fermentation cycles.. Here, we enhanced the utilization efficiency of xylose by strengthening the isomerase pathway.

    Amplification:

    Article Title: Metabolic Engineering of Escherichia coli for the Production of Cadaverine from Lignocellulose.
    Article Snippet: Efficient production of biobased monomers from lignocellulosic hydrolysates is considered an important approach to reducing product costs and achieving sustainable biomanufacturing.. However, the low conversion efficiency leads to a low yield and extended fermentation cycles.. Here, we enhanced the utilization efficiency of xylose by strengthening the isomerase pathway.

    DNA Purification:

    Article Title: Metabolic Engineering of Escherichia coli for the Production of Cadaverine from Lignocellulose.
    Article Snippet: Efficient production of biobased monomers from lignocellulosic hydrolysates is considered an important approach to reducing product costs and achieving sustainable biomanufacturing.. However, the low conversion efficiency leads to a low yield and extended fermentation cycles.. Here, we enhanced the utilization efficiency of xylose by strengthening the isomerase pathway.

    Agarose Gel Electrophoresis:

    Article Title: Metabolic Engineering of Escherichia coli for the Production of Cadaverine from Lignocellulose.
    Article Snippet: Efficient production of biobased monomers from lignocellulosic hydrolysates is considered an important approach to reducing product costs and achieving sustainable biomanufacturing.. However, the low conversion efficiency leads to a low yield and extended fermentation cycles.. Here, we enhanced the utilization efficiency of xylose by strengthening the isomerase pathway.

    Homologous Recombination:

    Article Title: Metabolic Engineering of Escherichia coli for the Production of Cadaverine from Lignocellulose.
    Article Snippet: Efficient production of biobased monomers from lignocellulosic hydrolysates is considered an important approach to reducing product costs and achieving sustainable biomanufacturing.. However, the low conversion efficiency leads to a low yield and extended fermentation cycles.. Here, we enhanced the utilization efficiency of xylose by strengthening the isomerase pathway.



    Similar Products

    97
    Vazyme Biotech Co multis one step cloning kit
    Multis One Step Cloning Kit, supplied by Vazyme Biotech Co, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/c113/ClonExpress+MultiS+One+Step+Cloning+Kit/pmc12995870-48-40-45
    Average 97 stars, based on 1 article reviews
    multis one step cloning kit - by Bioz Stars, 2026-09
    97/100 stars
      Buy from Supplier

    97
    Vazyme Biotech Co clonexpress multis one step cloning kit
    Clonexpress Multis One Step Cloning Kit, supplied by Vazyme Biotech Co, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/c113/ClonExpress+MultiS+One+Step+Cloning+Kit/custom%40c113%4010%2E1016%2Fj%2Eisci%2E2026%2E116630
    Average 97 stars, based on 1 article reviews
    clonexpress multis one step cloning kit - by Bioz Stars, 2026-09
    97/100 stars
      Buy from Supplier

    97
    Vazyme Biotech Co one step cloning kit
    One Step Cloning Kit, supplied by Vazyme Biotech Co, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/c113/ClonExpress+MultiS+One+Step+Cloning+Kit/pm42031249-62-21-24
    Average 97 stars, based on 1 article reviews
    one step cloning kit - by Bioz Stars, 2026-09
    97/100 stars
      Buy from Supplier

    Image Search Results